Table 1

Primers used for sequencing beta-lactamase genes from Escherichia coli isolates and their transconjugants

TargetPrimer nameOligonucleotide sequence (5′–3′)Product size (bp)Reference
ForwardReverse
blaCTX–M group A1CTX–M–1 upstreamATGTTGTTGTTAATTCGTCTCCGTTATCGCTGTACTGTAG44652
CTX–M–1 downstreamTTAACTATAATCCGATTGCGTTTCTGCCTTAGGTTGAG50752
blaCTX–M group 9CTX–M–4 upstreamATTCCGCTGCTGCTGGGCAGGCGGCGTGGTGGTGTCTCTC511This study
CTX–M–4 downstreamCGGGAGGCGTGACGGCTTTTTTGCCACGGAACGGTCTGCG520This study
blaCMY–2AmpCATGATGAAAAAATCGTTATGCTTGCAGCTTTTCAAGAATGCGC1,14325
blaTEMTEMATAAAATTCTTGAAGACGAAAGACAGTTACCAATGCTTAATCA1,07429