Table 2

Primers used in this study

PrimerSequence (5′–3′)Efficiencya
ForwardReverse
Mutational analysis
    aroATACGCCGCCGACTTTCGCCTCCGTCGACTGGCGCAACAGA
    entBCAGCGGTTGGCGTCACGTTCGATCGAAGCCGATCACCCGCG
    trpBCTGGGTCTGAAATGCCGTATACCACCAGCAGTTGCTCTTT
    iroBACGCGCGTAAATAAGCCTGAAACCCACGCGGGCAAGGCGAACTAT
    T7TAATACGACTCACTATAGGG
    SP6ATTTAGGTGACACTATAGAA
    iroB-d1ATGCGTATTCTGTTTGTCGGTCCACCACTGTATGGACTGCGTGTAGGCTGGAGCTGCTTC
    iroB-d2TTAGCCGTGTTGCAGCATGGCGATCAGTTTTTTTGCCACCCATATGAATATCCTCCTTAG
RT-qPCR
    iroBGTCAGGAGGCATTACGAACGGGTCAGTCATCTCTTC95.4
    entATTTGTTTCTTGCCTCCGATGGCTCCCAATGTTGAACC83.2
    entFCATCATACCGCTTACATCATTTTGACTATCGCCGTTTGT94.9
    gapAGAAACTGGTCTCCTGGTATTGGAGATGTGAGCAATC96.4
    dnaNGATTTCCCGAATCTTGACAACAGCATACCGTTTAAG102.0
    gyrBCGTTTGTTGAATATCTGAAGGAATGTTGTTGGTAAAG89.3
    rplUGAGTTCGCTGAAGTTCTGATTTGATTACGCCGCCATC98.5
    rpoDGTGGATACCGTCTTATGGGATAGCCTTGCTCCTTAC91.4
    rpsLGCGTATGTACTCGTGTATATTCAAAACCGTTAGTCAGA97.1
  • a Primer efficiencies were determined with the MyiQ Cycler software from a standard dilution curve of S. Typhimurium chromosomal DNA as described in Materials and Methods.