Table 3

Primer information related to genes targeted in RT-qPCR experiments

Type of gene targeted and primeraSequenceMelting temp (°C)Product size (bp)Targeted ORF/gene
Target genes
    A1056FwCCCCAGTACTCGATCTTCCA60.07192BBPR _1056
    A1056RevCAGCACGATGGTGAAGAAAA59.84BBPR _1056
    A1057FwGTCGGATTCCAGAACTTCCA60.05164BBPR _1057
    A1057RevAAACCGGTAACGTGCTTGAC60.04BBPR _1057
    A1058FwAAACGACTGCTTGCTGGTCT60.05201BBPR _1058
    A1058RevGATGTTCGGGTTGTCCTTGT59.84BBPR _1058
    A1353FwTGACGCCAGCTTCTACAATG60.01172BBPR _1353
    A1353RevTTTGAGATGGGTGTTGACCA59.94BBPR _1353
    A1354FwGAGACGGTCACCATCAACCT59.97168BBPR _1354
    A1354RevCTTGACGGTGTAGCCCTGAT60.13BBPR _1354
    A1356FwTCGTCTCCATGCTCATCAAC59.79103BBPR _1356
    A1356RevGTCACGATGTTGTCCCACAG60BBPR _1356
    P0030FwGATCGAGACGGTCGAGAAAA60.34174BBPR _0030
    P0030RevAGACCGATGACCAGCGATAC60.1BBPR _0030
    P0032FwACACCCTCGGCTACATTGTC60159BBPR _0032
    P0032RevCGGAGAAGACCAGGTACAGC59.87BBPR _0032
    P0239FwAGATTACCACGGTCGCTCAG60.28188BBPR _0239
    P0239RevCTTGACCACATTCCAGTCCA59.52BBPR _0239
    P0240FwCGATGACGATAACGACGATG60.1146BBPR _0240
    P0240RevGGGTGATGCAGTTCTCGATT60.08BBPR _0240
    P1715FwACCCTTGACATGGAAGTGCT59.58135BBPR _1715
    P1715RevGTCGCCGGACTTCATCTTC60.76BBPR _1715
    P1717FwCTCGTGGGTCTACACCACCT60.03152BBPR _1717
    P1717RevAGACCTGGCACACCTGGTAG60.17BBPR _1717
    P1508FwGGTGTTCATCAAGGCCATCT59.93164BBPR _1508
    P1508RevTCCACTTTTCGGAGTCCATC60.05BBPR _1508
    P0366FwTCAACCTGCTGCTTGACAAC60.03185BBPR _0366
    P0366RevGAGCTTGCAGAACACCATGA59.99BBPR _0366
    M0561FwAAACCACCAAGCCAGTCAAC60.01189BBPR _0561
    M0561RevGCACGGAGAAGATCAGGAAC59.81BBPR _0561
    M1459FwCTCGTGGACAACACGAACAC60.2210BBPR _1459
    M1459RevCATGCCCCAGTAGGAGATGT59.95BBPR _1459
    M0145FwATGATCGGCCTGATTACGAC59.92145BBPR _0145
    M0145RevGATCCCTCCGAAGTCATCTG59.61BBPR _0145
    M1399FwGGCACGACAATCATCTCCTT60.08158BBPR _1399
    M1399RevGCCAGACCGTTCATCTCATT60.08BBPR _1399
    A1074FwGCAGATGTGCCTGAAAATCA59.81153BBPR _1074
    A1074RevATCAGCGTGCTCTTGAGGTT60.02BBPR _1074
Reference genes
    uvrD/Rep-FATACTCCGAGAATGCGGATG60.06165uvrD/rep
    uvrD/Rep-RACGACATCCCGCTCATATTC59.92uvrD/rep
    pdxS-FATGATCAAGGGCATTCAGGA60.43172pdxS
    pdxS-RCGTCGAACTGTGTCTTGTCG60.5pdxS
    gluC-FCGCATCTCTCCGATATCCTC59.76184gluC
    gluC-RACAGACTCAGTCCCGTCACC60.16gluC
    1653_fwCTTCTCGTGGTGCTCGGTAT60.28171atpB
    1653_revCGTGAAGAACAACGTCGAAA59.88atpB
    1691_fwGTGGATATACCCGGTCGATG60.04164glnD
    1691_revTAGTGACGGTCGTCATACCG59.59glnD
    B.bif1CCACATGATCGCATGTGATTG63.3127816S rRNA
    B.bif2CCGAAGGCTTGCTCCCAAA65.7616S rRNA
  • a The direction of the primer is indicated at the end of the primer designation as follows: Fw and F, forward; Rev, R, and rev, reverse.