Table 2

Primers used in this study

Target genePrimer namePrimer sequence (5′→3′)Reference or description of designAnnealing temp used (°C)
16S rRNAfD1AGAGTTTGATCCTGGCTCAG4655
rP2ACGGCTACCTTGTTACGACTT
dnaKTSdnaK4GGCAAGGAGCCGCAYAAGG2953
TSdnaK2GTACATGGCCTCGCCGAGCTTCA
glnBTSglnBFAAGCTCGAGTACATCTGGMSCTCGACGG2953
TSglnBRSGAGCCGTTCCAGTCGGTGTCG
recArecA41FTTCGGCAAGGGMTCGRTSATG4553
recA640RACATSACRCCGATCTTCATGC
nodAnodAF28GAAGGATCTTCTGGGCGCGDesigned from nodA of B. japonicum45
nodAR627CTCAGGCCCGTTACGATCG    USDA110 (NC_004463)
nodAYF46GCTCAAGTGCAGTGGAGCCTTCDesigned from nodA of B. yuanmingense53
nodAYR595CCGGCCATTCGCTTATCGAGCG    CCBAU10071 (AM117557)
nodAF25-ORS285GTATGCTGGGAGAGTGATCTCGDesigned from nodA of Bradyrhizobium46
nodAR584-ORS285GGCCCATTCCTCTCAATCGTTG    sp. strain ORS285 (AF284858)
nodA-CI1F45CTCGC(C/T)(G/A)AGTTCTTCCGCAA(G/A)AGDesigned from nodB of Bradyrhizobium52
nodA-CI1R498CCACCACGATCACGTCTTC(G/A)ATG    sp. strain ORS301 (AJ437608) and ORS304 (AJ437610) nodulating CI group 1 Aeschynomene
nodAf.bradGTYCAGTGGAGSSTKCGCTGGG653
nodAr.bradTCACARCTCKGGCCCGTTCCG
nodA1fTGCRGTGGAARNTRBVYTGGGAAA645
nodAb1rGGNCCGTCRTCRAASGTCARGTA
nodABrMfCARSTKMGRTGGAGYSTDYGCTGGGA2760–50
nodAb1rGGNCCGTCRTCRAASGTCARGTA    (touchdown PCR)
nodBnodBF26CTGTCCGCTGCGACTACGCDesigned from nodB of B. japonicum47
nodBR625CGCGCCGTTGTAGTGCTGG    USDA110 (NC_ 004463)
nodBF6-BYCAGAGGTGCTCGATGTGCTGGCDesigned from nodB of B. yuanmingense55
nodBR536-BYGACGGATTACAAACCCGCGCCG    CCBAU10071 (AY923050) and LMTR28 (AY923048)
nodBF73-ORS285CTGACATTTGACGATGGGCCCGDesigned from nodB of Bradyrhizobium53
nodBR622-ORS285GCCCATGAAGAGCTGGGATCAG    sp. strain ORS285 (AF284858)
nodCnodCF195CGCCGAATGTCTGGAGTCGDesigned from nodC of B. japonicum45
nodCR1394CCTGAGTCATCAGCCGACC    USDA110 (NC_004463)
nodCF197-ORS285TGGCGTGCCTAGAGTCGATTGCDesigned from nodC of Bradyrhizobium53
nodCR1196-ORS285CACGGTGATTTGCGCGACAACC    sp. strain ORS285 (AF284858)
nodCF108-CanAACGCAAGGCGCAG(T/A)TCGC(A/T)GCDesigned from nodC of B. canariense53
nodCR860-CanATCGG(G/T)GTGTG(C/G)AGCGAGAAGC    BTA-1 (AJ560653) and CCBAU51257 (GU433570)
nodCFAYGTHGTYGAYGACGGTTC2241
nodCICGYGACAGCCANTCKCTATTG
nifHnifHFTACGGNAARGGSGGNATCGGCAA2248
nifHIAGCATGTCYTCSAGYTCNTCCA