Table 5

Multiple sequence alignment of the 29 variable nucleotide positions of the 16S rRNA gene fragment (336 bp) obtained from the 10 FLE types found in D. andersoni and D. variabilis adults from 12 localities in western Canada and for the different subspecies of Francisella tularensis

TaxonAlignment positiona
6182172173174175176177178179180181182183188189196198206208215217227260287288289306326
Type 1GCGAATTGACGGGGGCGTGATCCTGGGCC
Type 5...........................G.
Type 9..............A..............
Type 10....................C........
Type 2...................G.........
Type 4AT..TGCG.TT.A....
Type 3AT........A.....TGCG.TT.A....
Type 6AT........A.....TGCG.TT.A...G
Type 8AT........A....TTGCG.TT.A....
Type 7AT........A.....TGCG.TT.AAT..
F. tularensisb...................G...A.....
  • a A dot (.) represents the identical nucleotide, and a dash (-) indicates a deletion with respect to the sequence of the type 1 FLE. The alignment position indicates the nucleotide position relative to the 3′ end of the forward primer.

  • b Sequence of F. tularensis subsp. tularensis, F. tularensissubsp. holarctica, F. tularensissubsp. mediasiatica, and F. tularensissubsp.novicida (GenBank accession no. AJ749949, AY968229, AY968235, and AY968237).