Table 1

Strains, plasmids, and oligonucleotide primers

Strain, plasmid, or primerDescription or sequence (5′ → 3′)aReference
Strains
    C7258Wild type (El Tor, Ogawa)Peru isolate, 1991
    C7258ΔlacZC7258 lacZ deletion mutant36
    AJB80C7258 ΔlacZ Δhns::Km36
Plasmids
    pTT3Transcription terminator rrnB T1T2 cloned in pUC1935
    pKRZ1Plasmid containing promoterless lacZ gene33
    pTT3VpsA0.6-kb SphI-HindIII vpsA promoter inserted downstream of transcription terminator in pTT3This study
    pVpsA -LacZ1.0-kb KpnI-HindIII terminator-vpsA promoter fragment inserted upstream of promoterless lacZ gene in pKRZ1This study
    pTT3VpsL0.6-kb SphI-HindIII vpsL promoter fragment in pTT3This study
    pVpsL -LacZ1.0-kb KpnI-HindIII terminator-vpsL fragment in pKRZ1This study
    pTT3VpsRspan lang=DE>0.6-kb SphI-HindIII vpsR promoter fragment in pTT3This study
    pVpsR -LacZ1.0-kb KpnI-HindIII terminator-vpsR fragment in pKRZ1This study
    pTT3VpsT0.7-kb SphI-HindIII vpsT promoter fragment in pTT3This study
    pVpsT -LacZ1.1-kb KpnI-HindIII terminator-vpsT fragment in pKRZ1This study
    pBRHNSTranscription terminator rrnB T1T2 and the hns locus were sequentially cloned in pBR322This study
Primers
    HNS1CGCGGATCCGTGAGAAAAACAAGTGCCAC
    HNS2GATGCATGCTTCCTGAGCGAGAAGATAGC
    HNS-F31GATCGCATATGGTAATGTCGGAAATCACTAAG
    HNS-R32GATCGGCTCTTCAGCACAGAGCGAATTCTTCCAGAGA
    TcpA-F1GTTCATAATTTCGATCTCCACTCCG
    TcpA-R2GTTAACCACACAAAGTCACCTGCAA
    VC1922-F61TAGAAGGTTGACGAAACAAGCAATCA
    VC1922-R62GGTTCAACCACCATAGGTACGAGT
    VicH5GGGAAGCTTGTAATGTCGGAAATCA
    VicH396AGGAGATCTCAGAGCGAATTCTTCC
    VicH7GTTGCATGCATGTCGGAAATCACTA
    RpoS1020CTTCTGCAGTTACTTGTCGTCATCG
    RpsM-F51GCAACTGCGTGATGGTGTAGCTAA
    RpsM-R52GCTTGATCGGCTTACGCGGACC
    VpsA1GAAGCATGCGCGTAGTAGTGAATTTTTCC
    VpsA2GCGAAGCTTTACCTGATCTAACATCTCAC
    VpsAFCCTTTATATCGCGCTTAAACTATATGT
    VpsARATCCTCTTTAAAAAAGAAATTTCACAAAAT
    VpsL1GAAGCATGCGTAATGGTACGGGTTTCATA
    VpsL2GCGAAGCTTCCGTGATAGTTAGTAATGCG
    VpsLF1CTTTTCGATAAACGATACATATTATTTCT
    VpsLR1GCATGAAAATAAACTTTAGTTTACTTTTAT
    VpsR1GAAGCATGCGAGTCTGGTGATGATGAAGC
    VpsR2GCGAAGCTTAATCTGCTACTTGAGTACAG
    VpsRFTGGGGCTTTTTTTATTTCCTCAAGAAA
    VpsRRTCGATATTCCTTATTTTTATTGTTACGAT
    VpsT1GAAGCATGCGTTGGCATGTGGTTAAAGTG
    VpsT2GCGAAGCTTGCAAACATCAGAAAGCATTC
    VpsTF2AGGCTATGAATAAATTGAGTGGTAAGT
    VpsTR2GAAGACAAACGTTTAATCAAGCGGAA
  • a Restriction sites used for cloning are underlined.