Table 1

Quantitative PCR primers and FISH probes for the Beta, Firm-5, and Gamma-1 phylotypesa

Primer/probe and targetPrimer/probe namePrimer/probe sequenceqPCR product/probe length (bp)FISH probe fluorophore (5′ attachment)
qPCR primers
    BetaBeta-1009-qtFCTTAGAGATAGGAGAGTG128
Beta-1115-qtRTAATGATGGCAACTAATGACAA
    Firm-5Firm5-81-qtFGGAATACTTCGGTAGGAA114
Firm5-183-qtRCTTATTTGGTATTAGCACC
    Gamma-1Gamma1-459-qtFGTATCTAATAGGTGCATCAATT210
Gamma1-648-qtRTCCTCTACAATACTCTAGTT
FISH probes
    Betabeta-572TTAACCGTCTGCGCTCGCTT20Cy5
    Firm-5fir5-575TCCCGCCTGCGTTCG15Cy3
    Gamma-1gam1-1246CGAGGTCGCCTCCCTTTGTA20Texas Red-X
    Universal bacteriaeub339TGCTGCCTCCCGTAGGAG18Alexa Fluor 488
  • a The following touchdown reaction protocol was used for all reactions: 95°C for 10 min; 40 cycles of 95°C for 5 s, variable annealing temperature for 15 s, and 72°C for 5 s. The annealing temperature was 68°C for the first three cycles and was then lowered by 1°C for each cycle until it reached 55°C, with remaining cycles at 55°C.