Table 1

Bacterial strains, plasmids, and primers used in the study

Strain, plasmid, or primerMajor properties or DNA sequence(s) (5′ to 3′)aReference, source, or application
Strains
    S. mutans UA159Wild type, serotype c
    S. mutans OMZ175Wild type, serotype f2
    S. mutans TW14UA159 derivative, brpA deficient, erythromycin resistant43
    S. mutans TW14DUA159 derivative, brpA deficient, erythromycin resistant42
    S. mutans TW14KUA159 derivative, brpA deficient, kanamycin resistantThis study
    S. mutans TW230OMZ175 derivative, brpA deficient, erythromycin resistantThis study
    E. coli DH10BCloning host; mcrA mcrBC mrr hsdInvitrogen, Inc.
Plasmid
    pFW5-lucIntegration vector containing a promoterless luciferase gene and a spectinomycin resistance marker22
Primers
    5′ RACE AdapterGCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA5′ RACE
    5′ RACE OuterGCTGATGGCGATGAATGAACACTG5′ RACE
    5′ RACE InnerCGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG5′ RACE
    RACE brpA RevGTCAACTCCCATTAAGAGGATAC5′ RACE
    brpA check FwGTTTACCTTAGGAGGAAACTGA5′ RACE
    brpA SP1ACCTTTGGCAATTCCTTTTGTCASequencing
    brpA SP2AACTGACTTGACAGATAAAAACTSequencing
    PbrpATTATGATGCTAGCAAGTCTCAAAGACA (forward), TCAGTTTCCTCCTCGAGTAAACATC (reverse)Promoter-reporter fusion
    SMU.409-brpAAAGGCTGCCACTTTATCATTTGGATG (forward), AATCTTAATATCAAGCATATCCTGAA (reverse)RT-PCR
    brpA:ermAGCTCAGATAAGGCTGAGCTCCTA (forward), AAACCGTCTTTCATGCCCATGTGCAT (reverse)ΔbrpA:erm amplification
    SMU.409P5TACAGCTAACTCTTCTGCAACACCATC (forward), ATTCGATAGGGATCCAAATGATAAAGTG (reverse)5′ fragment for polar insertion
    SMU.409P3CACTTTATCATTTGGATCCCTATCGAAT (forward), ACGATACTTGCTGACACTGTCTAAAGCT (reverse)3′ fragment for polar insertion
    SMU.246TCCTTCTTATGATTGGTGTT (forward), CTACTACTTCTTGACGGTAAT (reverse)SMU.246 fragment, 135 bp
    SMU.549GCAGTCTCTTACGATTATGG (forward), GCTACAACAGGAGGAACT (reverse)SMU.549 fragment, 84 bp
    SMU.599GTGCGACTACTATTCCTCAA (forward), TCTTCAACTTCTGCCAACT (reverse)SMU.599 fragment, 82 bp
    SMU.1677CTCATTATGGAAGTCTCAA (forward), AAGTAGGATGTTCAATCG (reverse)SMU.1677 fragment, 121 bp
    SecAGTGCTTCCATTACCTATCA (forward), ATTCCTCTTCTTCTGTCTTC (reverse)secA fragment, 87 bp
    SecYCAGGAAGTGTGGTTGTAA (forward), GCTTGAACGGATATTGAC (reverse)secY fragment, 155 bp
    BrpACGTGAGGTCATCAGCAAGGTC (forward), CGCTGTACCCCAAAAGTTTAGG (reverse)brpA fragment, 148 bp
  • a Nucleotides underlined are restriction sites engineered for cloning.