Table 1

Primers and PCR cycling conditions used in detection of serotypes and virulence genesa

GenePrimerSequence (5′–3′)Cycling conditionsAmplicon size (bp)Reference
wzx wzxO26-F CAGAATGGTTATGCTACTGT 30 cycles of 20 s at 95�C, 40 s at 60 to 54�C, and 30 s at 72�C423 13
wzxO26-R CTTACATTTGTTTTCGGCATC
WzxO103-F TTGGAGCGTTAACTGGACCT 30 cycles of 20 s at 95�C, 40 s at 57�C, and 30 s at 72�C321 13
wzxO103-R GCTCCCGAGCACGTATAAG
wzxO111-F TAGAGAAATTATCAAGTTAGTTCC 30 cycles of 20 s at 95�C, 40 s at 62�C, and 30 s at 72�C406 13
wzxO111-R ATAGTTATGAACATCTTGTTTAGC
wzxO145-F CCATCAACAGATTTAGGAGTG 30 cycles of 20 s at 95�C, 40 s at 59�C, and 30 s at 72�C609 13
wzxO145-R TTTCTACCGCGAATCTATC
wzxO157-F CGGACATAAATGTGATATGG 30 cycles of 20 s at 95�C, 40 s at 60�C, and 30 s at 72�C259 13
wzxO157-R TTGCCTATGTACAGCTAATCC
stx 1 stx1-F ACACTGGATGATCTCAGTGG 35 cycles of 1 min at 95�C and 2 min at 65�C for the first 10 cycles, gradually decreasing to 60�C by cycle 15, and 1.5 min at 72�C614 15
stx1-R CTGAATCCCCCTCCATTATG
stx 2 stx2-F GGCACTGTCTGAAACTGCTCC 35 cycles of 1 min at 95�C and 2 min at 65�C for the first 10 cycles, gradually decreasing to 60�C by cycle 15, and 1.5 min at 72�C255 14
stx2-R TCGCCAGTTATCTGACATTCTG
eaeA eaeA-F GTGGCGAATACTGGCGAGACT 35 cycles of 1 min at 95�C and 2 min at 65�C for the first 10 cycles, gradually decreasing to 60�C by cycle 15, and 1.5 min at 72�C890 15
eaeA-R CCCCATTCTTTTTCACCGTCG
hlyA hlyA-F ACGATGTGGTTTATTCTGGA 35 cycles of 1 min at 95�C and 2 min at 65�C for the first 10 cycles, gradually decreasing to 60�C by cycle 15, and 1.5 min at 72�C165 15
hlyA-R CTTCACGTGACCATACATAT
espB epsB-F CGGGATCCCGTGAGATGGTCAC 30 cycles of 1 min at 95�C, 1 min at 55�C, and 1 min at 72�C600 16
espB-R CGCTCGAGGGTTGGACTTGACA
espBO157 espB/O157-F GATAATACTCAAGTAACGATGGTT 30 cycles of 1 min at 95�C, 1 min at 59�C, and 1 min at 72�C920 16
espB/O157-R CCCAGCTAAGCGACCCGATT
rfbO157 PF8 CGTGATGATGTTGAGTTG 30 cycles of 1 min at 94�C, 1 min 53�C, and 1 min 72�C420 17
PR8 AGATTGGTTGGCATTACTG
fliC H71806 GCTGCAACGGTAAGTGAT 30 cycles of 1 min at 94�C, 1 min 53�C, and 1 min 72�948 17
1809 GGCAGCAAGCGGGTTGGT
  • a Cycling conditions and references apply to both primers in each primer pair.