Table 2

Primers used in multiplex PCR assays and their concentrations

PrimerTarget geneTm (°C)OrientationaSequence (5′–3′)Size (bp)GenBank accession no.Primer concn (μM) for:
Multiplex PCRLabeling
Group A
    wl-52601O1/O7 wzt56.3FTGGGRTCAATGATAGATACTCC817Lab data0.20
    wl-5260356.3RCCAATSCAACTGWGGTCTWATC0.200.20
    wl-41032O2/O3 wzt49.4FTTCAGAAATCCTCTGGAAG908Lab data0.60
    wl-4103349.9RATTTGCTTGGAGAACCTTA0.600.60
    wl-41037O4 wzm51.1FCAACTCCGGATTGGTAAA243Lab data0.12
    wl-4103854.9RTTCAAATCGCGGTACCTG0.120.12
    wl-41388O5 wzt49.4FATAATAAAGCAAGCCTTGAT293Lab data0.12
    wl-4138947.7RTTCTGGATGAAAACCAGTC0.120.12
    wl-22688O6 wzt53.7FTAAAGATATTGTAGAGAGCCAGC517Lab data0.12
    wl-2268952.7RCATAGAGAGATAACCCTCACATT0.120.12
    wl-52835O9 wzm47.1FACAGATGGTTTGCCTTAC420Lab data0.40
    wl-4104052.2RTTCATACCAAAACCGCAG0.400.40
Group B
    wl-47909O8/O14 wzt45.5FCAATACGAGATTAAAAGAAA343Lab data0.20
    wl-4791040.3RCTTTGGTCTTAATAAGCCATC0.200.20
    wl-41046O10 wzm46.7FACACTTTTAGGCTTTGGT645Lab data0.40
    wl-4104749.1RCCCAAGCATAAAAACAATA0.400.40
    wl-50709O11 wecA55.0FTTGAATTCATTATTTCTTTTCG228Lab data0.40
    wl-5071153.7RATGAATAATAAACTAATTAACTGA0.400.40
    wl-41050O12/O15 wzm50.2FGGGGATATTCAACCGTTA751Lab data0.40
    wl-4105145.1RTAAATCCTATTACAAATATAGC0.400.40
    wl-41044O13 wzm50.0FTTGTCATTTGTGCCACAG297Lab data0.40
    wl-4104547.3RGCCAATTACCCTTTAAAC0.400.40
Positive controls
    Wl-311016S rRNAFTGTACACACCGCCCGTC500–1,000AB553285.10.08
    Wl-3111RGGTACTTAGATGTTTCAGTTCAY987650.10.080.13
  • a F, forward primer; R, reverse primer.