Table 3

Oligonucleotide probes used in this study

Probe nameTarget gene or virulence factorTm (°C)aSequence (5′–3′)GenBank accession no.
OA-3383O1 wzt67.8CAGTCATGGATATCACTCGCGACTATCTCCP000675.2
OA-338667.6GCGAAATATAAATCGGAACAGGTTTGG
OA-3761O2 wzt63.9GTTAGCAGTTGGAGATCAGGATTTTCALab data
OA-376261.2GCCATGATATGAGTGCTATTGAATCGATTTG
OA-3762O3 wzt61.2GCCATGATATGAGTGCTATTGAATCGATTTGLab data
OA-375866.1TATTAGCAGTAGGAGATCAAGATTTTCAAA
OA-3702O4 wzm65.8CAACTCCGGATTGGTAAATAAAATTTATTTTLab data
OA-370371.4CGGTTTAATTATAATTTGCGCCACCATTTATG
OA-3377O5 wzt69.9CAAGCCTTGATGATGAGAATACTCAAAAATCCLab data
OA-370567.0GAAACAGAAGAGTTCCAGAGTTTGTGTAAGG
OA-370674.8CCAAATATCACCTGGCGAACGCATAGGTTTAA
OA-370766.7ATCCAGAATAACTACTCCGACTTATGGTGAA
OA-3373O6 wzt67.0TAGATTCAATTGCAAGATCTCATGCCCLab data
OA-337463.8ACAAGGTTCTTATTCATTCTCTTAAGCTTTT
OA-3770O7 wzt66.0CTGTGTAGAGCTTAATTGTGTGAGATTATTGGLab data
OA-379266.0AAATGCAAATTCAGTCAGTAAAAGTTCAGTG
OA-379369.0CCATAGTCCAATGCGTTTTTTAAACTGTGTAG
OA-3680O8 wzt64.2TACAGATTTAGAAAATAATGGACCAGCAATLab data
OA-377660.4TTCACTTGTCATTACAGATTTAGAAAATAAT
OA-3359O9 wzm67.8CCTACAGATCAGTAGAGGGTAACGCCGLab data
OA-336065.7TCCCTACAGATCAGTAGAGGGTAACGC
OA-379968.2GCTTGGTGGGACATATACCCTATCTGCT
OA-380061.6CCTTTGTGCCATTTTATATCATAAACTT
OA-380164.4TTTTCAGTTATTCGTGCTATTTCCTTTTT
OA-380276.0GTTTCAGCTTCACCACATTGGCTGCGGTTT
OA-3366O10 wzm64.8CCTTGTTGGATTTGGTTTAATAATAATTTGTLab data
OA-336764.3TTTAGGATTAATGTTGGCTCCTTTTAGTACT
OA-3771O11 wecA64.1TATTATTTATTTTCTTACACCGCATTATTGGLab data
OA-377259.0TCATCTCATATTGATTCAGTTAATTAGTTT
OA-377359.4CATATTGATTCAGTTAATTAGTTTATTATTCAT
OA-377467.3GATTATAAATCACGAAAAATGGTTTAGCCCT
OA-377564.1TTGAATTCATTATTTCTTTTCGATTCTACAG
OA-3369O12 wzm63.4CAGTTATAGAGATGCACTAAATGGTCGATLab data
OA-337065.5TTCACCTCATTGGTTAAGATTCTGGTATG
OA-3361O13 wzm62.2TGCCACAGTTTATGATAAACTTAATTATCALab data
OA-336260.0CCTACTATTTGTTATTCAAGCAATGTTT
OA-336363.1TTTGTACCACTGGCATTACAATTTTATTAT
OA-3680O14 wzt64.2TACAGATTTAGAAAATAATGGACCAGCAATLab data
OA-377660.4TTCACTTGTCATTACAGATTTAGAAAATAAT
OA-3369O15 wzm63.4CAGTTATAGAGATGCACTAAATGGTCGATLab data
OA-337065.5TTCACCTCATTGGTTAAGATTCTGGTATG
OA-199316S rRNA gene71.91380-TTGTACACACCGCCCGTCACACCAT-1404bX80725
WL-4006TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTc
Cy3TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-Cy3d
  • a Tm was predicted using Primer Premier 5.0 software.

  • b The 16S rRNA gene-based probe was used as the positive control.

  • c The probe containing 40 poly(T) oligonucleotides was used as the negative control.

  • d The probe labeled with 3′-Cy3 was used as the positional reference and printing control.