Table 2

The four novel cry1-type genes cloned from the wild-type B. thuringiensis strain and the primers for amplification of the full-length genes

Gene typePrimersaSource strainHolotype gene (% identity)bToxincGenBank accession no.
cry1Ai1AiF: ATGGATAACAATCCGAACATCAATGSC6H8cry1Ai1 (99)Cry1Ai2HQ439780
1AiR: CTATTCTCCATAAGGAGTAATTCC
cry1Bb1BbF: TTGACTTCAAATAGGAAAAATGAGWBT-2cry1Bb1 (99)Cry1Bb2HQ439782
1BbR: CTATTCTTCCATGAGGAGTAGTTC
cry1Ja1JaF: ATGGAGATAAATAATCAGAAGCWBT-2cry1Ja1 (99)Cry1Ja2HM070030
1JaR: TCTTATTCCTCCATGAGGAGTAATT
cry1La1 LaF: ATGGATAACAATCCGAAAATCCAGBtS6cry1La1 (99)Cry1La2HM070031
1 LaR: TTATTCCTCCATAAGGAGTAATTC
  • a Oligonucleotide primers were designed according to the DNA sequence for full-length gene amplification.

  • b Data represent the identity score of the cloned gene compared with the relevant holotype gene.

  • c Toxins were named according to the B. thuringiensis Delta-Endotoxin Nomenclature Committee guidelines.