Table 2

RT-PCR primers and probes used for detection and confirmation of NV in hand rinse samples

AssayPrimer sequenceProbe sequenceaReference or source
Diagnostic RT-qPCRNVKS1-Forward: 5′-ACAGCATGGGACTCAACACA-3′NVKS3 probe: 5′-(FAM)TCACCAGAATTGGCCGAGGTTGT(BHQ-1)-3′Liu et al. (20)
NVKS2-Reverse: 5′-GGGAAGTACATGGGAATCCA-3′IAC probe: 5′-(TET)ATCTCAGTTCGGTGTAGGTCGTTCGCTCC(BHQ-1)-3′This study
Confirmation RT-PCR + hybridizationCOG1F: 5′-CGYTGGATGCGNTTYCATGA-3′Ring a: 5′-(FAM)AGATYGCGATCYCCTGTCCA(TAMRA)-3′Kageyama et al. (21)
COG1R: 5′-CTTAGACGCCATCATCATTYAC-3′Ring b: 5′-(FAM)AGATCGCGGTCTCCTGTCCA(TAMRA)-3′
  • a FAM, 6-carboxyfluorescein; TET, tetrachlorofluorescein; BHQ-1, black hole quencher 1; TAMRA, 6-carboxytetramethylrhodamine.