Table 2

Sequences for Salmonella serovar-specific E-DNA target regions, synthetic LAMP target amplicons, and E-DNA probes

DNA and serovarSequencea (5′–3′)Gene position
E-DNA target region
    S. TyphimuriumCTTCGCTCTGTAATCGCCCGTG843–864
    S. CholeraesuisCTTCGCCCTGCAGGCGCCCGTG843–864
Synthetic LAMP target amplicons
    S. Typhimurium barbellGATAAGCAGGGCGACAGCAAGCTCCGCGATCTTGTGACCGTCGGTACCGTCGATACGGACCTTGCTGTCGCCCTGCTTATCTTTGGTTAAGCCAATCGACGTCTCACGCTCTTCGCTCTGTAATCGCCCGTGAAGAACAAACGCTTCCTGCT GCGTGAGACGTCGATTGGCT
    S. Choleraesuis barbellGATAAGCAGGGCGACAGCAAGCTCCGCGATCTTGTGACCGTCGGTACCGTCGATACGGACCTTGCTGTCGCCCTGCTTATCTTTGGTTAAGCCAATCGACGTCTCACGCTCTTCGCCCTGCAGGCGCCCGTGAAGAACAAACGCTTCCTGCTGCGTGAGACGTCGATTGGCT
    Nonspecific barbellAGCCAATCGACGTCTCACGCAGCAGGAAGCGTTTGTTCTTCACGGGCGATTACAGAGCGAAGAGCGTGAGACGTCGATTGGCTTAACCAAAGATAAGCAGGGCGACAGCAAGGTCCGTATCGACGGTACCGACGGTCACAAGATCGCGGAGTTGCTGTCGCCCTGCTTATC
E-DNA probe
    S. TyphimuriumHS-trihexylthiol-CACGGGCGATTACAGAGCGAAG-(CH2)7-NH-MB
    S. CholeraesuisHS-trihexylthiol-CACGGGCGCCTGCAGGGCGAAG-(CH2)7-NH-MB
  • a Strain differences are in bold, and binding regions are underlined. MB, methylene blue.