Table 2

Primers used for PCR and QRT-PCR

PrimercNucleotide sequenceaLocationb
fliCF (RT-PCR)TTAGCTGCCACCCTTCATG2700535–2700517
fliCR (RT-PCR)TCGTCAAGTTGCCTGCATC2700385–2700403
fliCP (RT-PCR)TCTACGTATGCCTGGCTTCCACCG2700405–2700428
csgAF (RT-PCR)TACTATTACCCAGCATGGTGG1548878–1548898
csgAR (RT-PCR)CAAGAGTGGCGCTGTTACC1548984–1548966
csgAP (RT-PCR)CCACGTTGGGTCAGATCGATTGAG1548962–1548938
flhDCF(RT-PCR)ACAACATTAGCGGCACTGAC2655207–2655188
flhDCR (RT-PCR)AGAGTAATCGTCTGGTGGCTG2655107–2655124
flhDCP (RT-PCR)AAACGGAAGTGACAAACCAGCTGATTG2655131–2655158
csgDF(RT-PCR)CGCTGGCAATTACAGGAAAATTAC1547324–1547301
csgDR (RT-PCR)CTTTTTATCCGCTTCCATCATATCC1547224–1547248
csgDP (RT-PCR)ATATTCAACGTTCTCTGGACGATATCTCTTCAGGCT1547297–1547262
rpoAF (RT-PCR)GGCTTGACGATTTCGACATC4242887–4242906
rpoAR (RT-PCR)GGTGAGAGTTCAGGGCAAAG4242997–4242978
rpoAP (RT-PCR)TGAAGTTATTCTTACCTTGAATAAATCTGGCATTG4242976–4242942
csgBAC F AACAAAAAAAGAAAAATACAACGC1548016–1548039
csgBAC R GATCTCTAGATCTGAAGAGGGCGGCCATTG1549511–1549492
flhDCF(promoter)GATCGTCGACGTGCGCAACATCCCATTTCG5655748- 5655729
flhDCR(promoter)GATCAGATCTGTATGCATTATTCCCACCCAG5655349–5655329
csgDF (promoter)GATCAGATCTTGAAACCCCGCTTTTTTTATTG1547424–1547445
csgDR (promoter)GATCGTCGACAATGTACAACTTTTCTATCATTTC1547694–1547671
  • a Nucleotide sequence of E. coli primers used in this study were selected from the published genome sequence of E. coli O157:H7 strain EDL933 with the accession number AE005174.2.

  • b Location refers to the position of primer sequence in the genome of EDL933.

  • c Subscripts F, R, and P indicate forward primers, reverse primers, and TaqMan probes; “RT-PCR” denotes primers used in reverse transcriptase-based quantitative PCR.