Table 1

Mean frequency of primer homology to UNITE database ITS sequences

rDNAPrimerSequence (5′→3′)ReferenceaNon-3′ mismatch3′ mismatch3′ gapsNon-3′ gapsWeighted scoreb
SSUBITSACCTGCGGARGGATCA2.5110.8860.0280.0082.642
ITS1TCCGTAGGTGAACCTGCGG243.9401.1530.0550.0033.431
ITS5GGAAGTAAAAGTCGTAACAAGG246.4581.0380.0530.0004.173
ITS1-F_KYO2TAGAGGAAGTAAAAGTCGTAA166.1111.4480.0270.0024.238
ITS1-F_KYO1CTHGGTCATTTAGAGGAASTAA166.3531.5080.1380.0035.340
NSI1GATTGAATGGCTTAGTGAGG236.1081.4980.0560.0015.565
ITS1FCTTGGTCATTTAGAGGAAGTAA226.8581.5980.1080.0055.910
NSA3AAACTCTGTCGTGCTGGGGATA237.2251.5190.1110.0056.077
5.8S ReverseITS2_KYO1CTRYGTTCTTCATCGDT160.4290.1320.0130.0000.425
ITS2_KYO2TTYRCTRCGTTCTTCATC160.4380.1460.0100.0010.492
B58S3GAGATCCRTTGYTRAAAGTT0.5330.1650.0120.0000.534
58A2CTGCGTTCTTCATCGAT230.4950.1870.0110.0010.545
ITS2GCTGCGTTCTTCATCGATGC240.6440.1950.0270.0010.704
5.8S ForwardITS3_KYO2GATGAAGAACGYAGYRAA160.5020.1090.0110.0000.399
gITS7GTGAATCATCGARTCTTTG150.5060.1350.0140.0000.461
ITS3_KYO1AHCGATGAAGAACRYAG160.4020.1420.0120.0010.478
fITS7GAACACAGCGAAATGTGA150.5750.1350.0160.0000.497
58A2ATCGATGAAGAACGCAG230.5020.1850.0120.0010.531
58A1GCATCGATGAAGAACGC230.5140.1910.0100.0010.569
ITS3GCATCGATGAAGAACGCAGC240.6670.1980.0270.0010.640
fITS9GAACACAGCGAAATGTGA151.6291.0850.0160.0011.901
LSUITS4_KYO1TCCTCCGCTTWTTGWTWTGC164.2741.1070.0390.0023.846
ITS4TCCTCCGCTTATTGATATGC244.4891.4800.0570.0044.070
ITS4_KYO2RBTTTCTTTTCCTCCGCT164.1811.3510.0150.0014.253
ITS4_KYO3CTBTTVCCKCTTCACTCG163.8041.4460.0160.0024.703
NLB4GGATTCTCACCCTCTATGAC236.4100.8190.0250.0025.228
ITS4BCAGGAGACTTGTACACGGTCCAG227.5281.6940.1270.0056.198
  • a In cases where no reference is listed, this study is meant.

  • b Weighted score = (non-3′ mismatches × 0.4) + 3′ mismatches + non-3′ gaps + (3′ gaps × 3.0) + (final 3′ base mismatch × 3.0).