Table 2

Probes and primers employed in this study

ProbePrimer (alternative name)Sequence (5′ to 3′)TargetGenBank accession no.Reference
cadA1cadA1-Tn5422FCAGAGCATTTACTGACCATCAATCGTTTn5422-associated cadA (cadA1) L28104 16
cadA1-Tn5422RTCTTCTTCATTTAACGTTCCAGCAAAAATn5422-associated cadA (cadA1) L28104 16
cadA2cadA2-pLM80FACAAGTTAGATCAAAAGAGTCTTTTATTcadA (LMOh7858_pLM80_0083) on pLM80 (cadA2) AADR01000058 16
cadA2-pLM80RATCTTCTTCATTTAGTGTTCCTGCAAATcadA (LMOh7858_pLM80_0083) on pLM80 (cadA2) AADR01000058 16
cadA3cadA3-EGDeFTGGTAATTTCTTTAAGTCATCTCCCATTcadA (lmo1100) in EGD-e (cadA3) AL591977 16
cadA3-EGDeRGCGATGATTGATAATGTCGATTACAAATcadA (lmo1100) in EGD-e (cadA3) AL591977 16
LMOSA_2330F (P1F)GCATACGTACGAACCAGAAGcadA (LMOSA_2330) on the chromosome of Scott A (cadA4) AFGI01000005.1 This study
LMOSA_2330R (P1R)CAGTGTTTCTGCTTTTGCTCCcadA (LMOSA_2330) on the chromosome of Scott A (cadA4) AFGI01000005.1 This study
LMOSA_2220F (P2F)CAACTTTGACCCTGTGGAGarsA (LMOSA_2220) on the chromosome of Scott A (arsA1) AFGI01000005.1 This study
LMOSA_2220R (P2R)CTTTCCATTCAATCACTGCGarsA (LMOSA_2220) on the chromosome of Scott A (arsA1) AFGI01000005.1 This study
pLI37_F (P3F)CAACCAGATCAGTTACCATTAACarsA on pLI100 (pli0037) and the chromosome of Scott A (LMOSA_2260) (arsA2) NC_003383 This study
pLI37_R (P3R)TGCTTCTCCAGAGATTTCTTCTGarsA on pLI100 (pli0037) and the chromosome of Scott A (LMOSA_2260) (arsA2) NC_003383 This study
F2365_2257F (P4F)ACATTGCGAGAACACCTTGGLMOf2365_2257 NC_002973.6 This study
F2365_2257R (P4R)GATTTATCGGCGCAATGACGLMOf2365_2257 NC_002973.6 This study