TABLE 1

Sets of primers used for PCR amplifications and in silico PCR performances of the primer pairs

DomainPrimerTarget regionTarget positionaPrimer sequence (5′–3′)Amplicon length (bp)In silico performanceb (%)
BacteriaBact1FV4514GTGCCAGCAGCCGCGGTAATA27587
Bact1RV4789GCGTGGACTACCAGGGTATCT
Bact2FV5–V6778CAAACAGGATTAGATACCCTG30480.5
Bact2RV5–V61,082CGTTRCGGGACTTAACCCAACA
ArchaeaArch1FV2–V3155CGGRAAACTGGGGATAAT36083.6
Arch1RV2–V3515TRTTACCGCGGCGGCTGBCA
Arch2FV5–V6784GGATTAGATACCCSGGTAGTC31364
Arch2RV5–V61,097GYGGGTCTCGCTCGTTRCC
  • a According to Escherichia coli 16S rRNA gene numbering.

  • b With two mismatches allowed compared to the SILVA databases (release 117), using TestPrime (107).