TABLE 2

Primers used in this study

Primer nameNucleotide sequence (5′→3′)Restriction site
GalK-RvCATGGGATCCTTTGCGAAGAGTTTCAGCBamHI
GalK-FrCATGGAATTCAATGTCTTTTAAGGTAGCCEcoRI
LacA-FrCATGGAATTCCAAACCTCATCATCTGGEcoRI
LacA-RvCATGGGATCCACAAGGTGGAAGTTTTCBamHI
lacR-1CCCTCTACTATCTCGGTAACAACAAAC
lacR-2GCTATGGCGCGCCTTGTTTGAGCATATTATCACCAscI
lacR-3GCTAAGCGGCCGCGTCATCAAGCCTTAATAAACNotI
lacR-4CGTGAAACAACACTTGGAGATCTTG
LacT-FrCATGGAATTCATGGAAAGAACGTGTGEcoRI
LacT-RvCATGGGATCCGATACATGTCAACCTCCBamHI
lacT-1CGATTGCGGCCGCCGCTTGCCAGACTGCTTGGNotI
lacT-2CGATACATGTCAACCTCC
lacT-3AGGTTGACATGTATCGGATCTATGATGTGATTACGC
lacT-4CATGCCATGGCCAACAATCGCTGCTAACAGCNcoI
Spec-RGCTAAGCGGCCGCACTAAACGAAATAAACGCNotI
Spec-FGCTATGGCGCGCCCTAATCAAAATAGTGAGGAGGAscI
lacA-1CAAACCTCATCATCTGG
lacA-2ACAAGGTGGAAGTTTTC
lacG-1GCCCTTCTAATCGTGGTTGACG
lacG-2GCTTGATAAGCAGCTGTTGCGCC
lacT-1ATGGAAAGAACGTGTG
lacT-2GATACATGTCAACCTCC