TABLE 1

Primers used to amplify the gene fragments

GeneOrganism(s)NameSequenceReferenceaTm (°C)b
recABradyrhizobiumTS2recAfGCCCTGCGTATCGTCGAAGG19*59
TS2recArCGGATCTGGTTGATGAAGATCACC19*
MesorhizobiumrecA(6)f_bisGTAGAGGAYAAATCGGTGGA37*56
TS2recArCGGATCTGGTTGATGAAGATCACC19*
dnaKBradyrhizobium and MesorhizobiumTSdnaK2GTACATGGCCTCGCCGAGCTTCA1958
TSdnaK4GGCAAGGAGCCGCAYAAGG38
glnIIBradyrhizobium and MesorhizobiumTSglnIIfAAGCTCGAGTACATCTGGCTCGACGG1958
TSglnIIrSGAGCCGTTCCAGTCGGTGTCG19
nodABradyrhizobiumnodAf.bradGTYCAGTGGAGSSTKCGCTGGG3960–50 (20)
nodAr.bradTCACARCTCKGGCCCGTTCCG39
MesorhizobiumTSnodB1AGGATAYCCGTCGTGCAGGAGCA4060–50 (20)
TSnodD1-1aCAGATCNAGDCCBTTGAARCGCA40
nifHBradyrhizobium and MesorhizobiumnifHFTACGGNAARGGSGGNATCGGCAA4157
nifHIAGCATGTCYTCSAGYTCNTCCA41
  • a Primers from references marked with an asterisk were modified.

  • b Tm, annealing temperature. Values in parentheses are numbers of cycles for the decrease from the first temperature to the second temperature listed in the touchdown amplification protocol.