TABLE 1

Bacterial strains, plasmids, and primers used in this study

Strain, plasmid, or primer useRelevant characteristic(s)Reference or source
E. coli strains
    E. coli W (ATCC 9637)Wild typeATCC
    LY180ΔfrdBC::(frgZm celYEc) ΔldhA::(frgZm casABKo) adhE::(frgZm estZPp FRT) ΔackA::FRT rrlE::(pdc adhA adhB FRT) ΔmgsA::FRT19
    RG100LY180 ΔpuuPThis study
    RG101LY180 ΔpotEThis study
    RG102LY180 ΔpuuP ΔpotEThis study
    RG105EMFR9 ΔpotEThis study
    EMFR9LY180 furfural-resistant mutant (yqhD silenced)19
    EMFR35LY180 furfural-resistant mutant (yqhD silenced)This study
    XW092LY180 ΔyqhD13
    TOP10F′F′[lacIq Tn10 (Tetr)] mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL endA1 nupGInvitrogen (Carlsbad, CA)
Plasmids
    pLOI5249potE gene in NcoI-BamHI-digested pTrc99AThis study
    pLOI5408potABCD gene in AvaI-XbaI-digested pTrc99AThis study
    pLOI5409potFGHI gene in EcoRI-XbaI-digested pTrc99AThis study
    pLOI5410ydcSTUV gene in EcoRI-XbaI-digested pTrc99AThis study
    pLOI5411plaP gene in EcoRI-XbaI-digested pTrc99AThis study
    pLOI5412puuP gene in EcoRI-XbaI-digested pTrc99AThis study
    pLOI5414mdtJI gene in EcoRI-XbaI-digested pTrc99AThis study
    pLOI5415cadB gene in EcoRI-XbaI-digested pTrc99AThis study
    pKD4bla FRT-kan-FRT28
    pKD46bla γ β exo (Red recombinase), temperature-conditional replicon28
    pCP20FLP+ λ cI857+ λ pR Repts bla catF29
    pTrc99ApTrc bla oriR rrnB lacIqLaboratory collection
Primer uses
    potABCD cloningFor: CCCCCGGGCAAGGTGGTTAACCACAAACCThis study
Rev: GCTCTAGACGAATTGAAAATTAGCGTGTAA
    potFGHI cloningFor: CGGAATTCGTTAACGAACTTTCAGAAGGAAThis study
Rev: GCTCTAGAATTTGTGTCAGCAGATATAGCCA
    ydcSTUV cloningFor: CGGAATTCGAACAATTAATTACGACAGGAGTAAGThis study
Rev: GCTCTAGACAGCGGTTTGCCACAATTAC
    plaP cloningFor: CGGAATTCGCGACGGTTATCACCGTAAAThis study
Rev: GCTCTAGATGCGATTATTTTTCGCGAGA
    potE cloningFor: CATGCCATGGAACCTGTTGCCAGGTTTTGCAThis study
Rev: CGGGATCCAGCTTCCTCGGTGAAGAACA
    puuP cloningFor: CGGAATTCCAAACCTTATTACGCAGGGGAGThis study
Rev: GCTCTAGACATGTTGGGCTTCTTCGCTG
    mdtJI cloningFor: CGGAATTCACTTTGGTTTCGCTGAATTAAGThis study
Rev: GCTCTAGAAGGCGGGATATCCTGAAGAT
    cadB cloningFor: CGGAATTCTGACCCGGACTCCAAATTCAAThis study
Rev: GCTCTAGAACAACGGCAGGTTCTCGTTCA
    Deletion of puuPFor: TTTCAGGTCGACACGACCGCAAACCTTATTACGCAGGGGAGGCAGCAATTGTGTAGGCTGGAGCTGCTTCThis study
Rev: TGGCGCGGCGCATTACCCTCAGGCAGGATAATGCGGCGCGCATCCGACTACATATGAATATCCTCCTTAGT
    Deletion of potEFor: GTCATCAAGCCTCGTGATGCGCAAAGCACCCTGTTGAAAGGGGAAAAATTGTGTAGGCTGGAGCTGCTTCThis study
Rev: TTTAATAAAAAAAGGGCGGTCGCAAGATCGCCCTTTTTTACTTTGCTTTTCATATGAATATCCTCCTTAGT