TABLE 2

Oligonucleotide DNA primers used in this study

PCR targetaPrimer
orfX cluster
    X1FGTTCCTCCTAATTGAAGAGG
    X1RAATTCCACACTAAATGGTAC
    X2FTTAGTTTGAATTCTAGATTT
    X2RGCTGTATAATAATGTTGATT
    X3FAGGAAATGCAAATTAAAGAA
    X3RCCATTTACAGGATCTTTATA
    X4FGTGAAGAACGATTAGAATAC
    X4RTTCTTGACAGACTCATGTAG
ha cluster
    H1FAAGCTGGTGGACTCTTATTT
    H1RTATACTTAAGTTGTCATTTA
    H2FATGATAAGAATATACTGAAA
    H2RTTATTTTAAGTTTATATCCC
    H3FGGTGCTAAGTTTAAATTAAT
    H3RTTATTCAGTCCACCCTTCAT
21-kb plasmids of type A(B) strains
    1FTCTATGACTAGATTCTTTTC
    1RCTTGCTGAGTAAGGTCTATG
    2FGCGATACCAGTTGCCCACGC
    2RGCTTTTCCCTTTATCTCTTC
    3FAAGATCTTGAGAAATTAGTA
    3RCAATAATTGAACTTGATAAG
    4FAAGACGTTATAATATTAAGA
    4RTAGCTTTGCCGCTATATATT
    5FCTTTATTTATGGAATAGTTA
    5RATTGTTATTAAAACTATTTT
    6FAATAGGAAGTAGAAGTTTTA
    6RTAATGACTACACTAAATATC
  • a Forward (F) and reverse (R) primers for each amplicon are shown.