TABLE 1

Bacterial strains and plasmids used in this study

Strain or plasmidGenotype or relevant characteristicsaSource or reference(s)
Strains
    Escherichia coli
        One Shot TOP10 competent cellsF ϕ80lacZΔM15 ΔlacX74 recA1 endA1 mcrA Δ(mrr-hsdRMS-mcrBC) araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) nupGInvitrogen
        Alpha-Select Bronze and Silver EfficiencydeoR endA1 recA1 relA1 gyrA96 hsdR17(rK mK+) supE44 thi-1 Δ(lacZYA-argFV169) ϕ80lacZΔM15 FBioline
    Desulfovibrio alaskensis G20
        Wild typeDesulfovibrio alaskensis G20 (formerly Desulfovibrio desulfuricans G20); cured of pBG1; Nxr17, 28
        I2G20 with (Dde_3182) cycA encoding type I tetraheme cytochrome c3 interrupted by plasmid insertion; Kmr26
        CycA mutantG20 cycA::mini-Tn10 with (Dde_3182) cycA encoding type I tetraheme cytochrome c3 interrupted by a mini-Tn10 transposon; Kmr39
        QrcA mutantG20 qrcA::mini-Tn5 with (Dde_2932) qrcA encoding a subunit of type I cytochrome c3:menaquinone oxidoreductase interrupted by a mini-Tn5 transposon; KmrA. Deutschbauer
Plasmids
    pCR4Blunt-TOPOCloning vector; Kmr AmprInvitrogen
    pCR8/GW/TOPOCloning vector; SprInvitrogen
    pMO719Desulfovibrio shuttle vector; SRB replicon pBG1; Spr52
    pMO736A 763-bp fragment containing the 393-bp type I tetraheme cytochrome c3 (Dde_3182) and 343 bp of upstream region cloned into pCR4Blunt-TOPO; KmrThis study
    pMO738Complementing plasmid for the type I tetraheme cytochrome c3 (Dde_3182) fragment removed from pMO736 via PmeI/SnaBI digestion and ligated into the EcoRV site of pMO719; SprThis study
    pMO756Complementing plasmid for QrcA derived from pMO9075b with Paph(3′)-II::RBS::qrcA (Dde_2932); SprThis study
    pMO9072Modified from pMO719 with Paph(3′)-II and MCS; no RBS; for complementation constructs; Sprb20
    pMO9075Modified from pMO9072 with three fragments removed via restriction digests; for complementation constructs; SprbThis study
    pSC27Desulfovibrio shuttle vector; source of SRB replicon pBG1, mob; Kmr29
  • a Strr, streptomycin resistant; Nxr nalidixic acid resistant; Kmr, kanamycin resistant; Ampr, ampicillin resistant; Spr, spectinomycin resistant; aph(3′)-IIp, promoter from the kanamycin resistance gene aph(3′)-II; RBS, ribosomal binding site (TGCAGTCCCAGGAGGTACCAT); MCS, multicloning site.

  • b See Fig. S1 in the supplemental material.