TABLE 2

L. buchneri CRISPR spacer matches

StrainSpacer no.SequenceNo. of nt matches in spacer (among 30 nt)Protospacer match (accession no.)Annotation
Left flankProtospacerRight flank
LA 117515AAAATTCAGACAACAAAAAAAGCGCTCCGCAACGGCCATTGCAAAACGCT30Food metagenome (ASXE01000335)Putative phage Mu Gam protein
LA 115412ATGAAGTTCAAGCTGTGTCAAACTACGTTGAATCCCAAGGACAAAACTTA29Food metagenome (ASXE01000117)Putative phage transcriptional activator
LA 11522CTGGTTTTATAAACGGATATTGCGGCTTATATTAACGAGCTGAAATGGTT30Lactobacillus brevis/pLB925A02Plasmid mobilization protein
LA 11522CTGGTTTTATAAACGGATATTGCGGCTTATATTAACGAGCTGAAATGGTT30Lactobacillus buchneri CD034/pCD034-1Mobilization protein
LA 114710AGAATATCGACAACGCAGCTAAAGATAATCGTCAGAATTACCAGAAATTA29Food metagenome (ASXE01000848)Putative phage nucleotide-binding protein
NRRL B-309299TAAGCTTGGTGGAAAAAGGTGGCGGCCGCTTTGTGCAAGGTCAAGAAATG30Lactobacillus kefiranofaciens ZW3/pWW2Conjugal transfer protein
NRRL B-309293TTACGCTTTAACCGAGTTTCGTGATCTCAAAAGTAGCTACGCAAAAACTA30Lactobacillus paracasei/pLP5402Plasmid replication initiation
LA 11881TTCTTAGATGCCGCTTACTTGCCGTTAAAGCGGGATATCGTTCAAAAAGA28Lactobacillus plantarum ZJ316/pLP-ZJ103Transposase
LA 116121AAAATTCAGACAACAAAAAAAGCGCTCCGCAACGGCCATTGCAAAACGCT30Food metagenome (ASXE01000848)Putative phage nucleotide-binding protein
LA 116123CATTATGCTAAAGGTTCAGGTGTCTCACACGCTGAACTAGACAAAATTAT29Lactobacillus kisonensis F0435Phage tail tape measure protein
LA 116124CTTTATCTAGGAAATAAGCAGCCTCATTTGAAGCACCATGCCAAAAATGA30Food metagenome (ASXE01000470)Putative phage lysozyme