TABLE 1

Primer sequences for reverse transcription-qPCR used in this study

PrimerSequence (5′-3′)
icaA-forwardGGAAGTTCTGATAATACTGCTG
icaA-reverseGATGCTTGTTTGATTCCCTC
cidA-forwardAGCGTAATTTCGGAAGCAACATCCA
cidA-reverseCCCTTAGCCGGCAGTATTGTTGGTC
gyrB-forwardGGAGGTAAATTCGGAGGT
gyrB-reverseCTTGATGATAAATCGTGCCA