TABLE 3

Strains, plasmids, and primers

Strain, plasmid, or primerDescriptiona or sequence (5′–3′)Reference or purpose
Strains
    R. palustris
        CGA009Wild-type strain; spontaneous Cmr derivative of CGA00145
        CGA4005CGA009 ΔhupS ΔuppE nifA*; Nx10
        CGA4021CGA4005 ΔamtB1 ΔamtB2; NxΔAmtB10
        CGA4026CGA009 ΔhupS ΔuppE ΔamtB1 ΔamtB2; ΔAmtB12
    E. coli
        MG1655Wild-type K-12 strain; WT53
        K-12 JW1483Keio collection; ΔddpX::Km54
        K-12 JW5240Keio collection; ΔddpA::Km54
        K-12 JW0997Keio collection; ΔrutA::Km54
        K-12 JW2307Keio collection; ΔargT::Km54
        K-12 JW5510Keio collection; ΔpatA::Km54
        K-12 JW0838Keio collection; ΔpotF::Km54
        K-12 JW3840Keio collection; ΔntrC::Km54
        K-12/pCA24N(pASKA)ASKA collection; pCA24N52
        MG1655/pCA24N −GFPASKA collection; pCA24N with GFP removed using NotI digestionThis study
        K-12 JW0441-AM/pASKAamtBASKA collection; pCA24N-N-His-amtB (GFP minus)52
        MG1655ΔDdpXMG1655 ΔddpX::Km; ΔDdpXThis study
        MG1655ΔDdpAMG1655 ΔddpA::Km; ΔDdpAThis study
        MG1655ΔRutAMG1655 ΔrutA::Km; ΔRutAThis study
        MG1655ΔArgTMG1655 ΔargT::Km; ΔArgTThis study
        MG1655ΔPatAMG1655 ΔpatA::Km; ΔPatAThis study
        MG1655ΔPotFMG1655 ΔpotF::Km; ΔPotFThis study
        MG1655ΔNtrCMG1655 ΔntrC::Km; ΔNtrCThis study
        MG1655/pEVMG1655/pCA24N; WT pEVThis study
        MG1655ΔNtrC/pECMG1655 ΔntrC::Km/pCA24N; ΔNtrC/pEVThis study
        MG1655/pamtBMG1655/pCA24N-N-His-amtB+; WT/pamtBThis study
        MG1655ΔNtrC/pamtBMG1655 ΔntrC::Km/pCA24N-N-His-amt+; ΔNtrC/pamtBThis study
Plasmids
    pCA24NCmr; ASKA collection empty vector with IPTG-inducible promoter52
    pCA24N-amtB+Cmr; ASKA collection vector with IPTG-inducible promoter in front of N-terminal His-tagged amtB gene52
Primers
    ALM47CGGAAAGCGCAGCAATTTTTGTddpX upstream (E. coli)
    ALM48GAGCAATGTGGGACGAAACGddpX downstream (E. coli)
    ALM45ATATCCCCTGGCACACAGCddpA upstream (E. coli)
    ALM46CCAGCAGCGTTGGCGTAAAATAddpX downstream (E. coli)
    ALM51CCGCTTTGCAAACAAGCCrutA upstream (E. coli)
    ALM52ATCAGCGCACTTTGCTGCrutA downstream (E. coli)
    ALM49GCAAACACACAACACAATACACAACargT upstream (E. coli)
    ALM50CCATCAGGTACAGCTTCCCAargT downstream (E. coli)
    ALM53TGAAAGCGTGCTGTTAACGCpatA upstream (E. coli)
    ALM54ATCCCGATTTTCGCGATCGpatA downstream (E. coli)
    ALM55CTGGCCGGGAGAAAGTTCTpotF upstream (E. coli)
    ALM56TTACGGGTTTTCGCCTGCpotF downstream (E. coli)
    MO 7CAATCTTTACACACAAGCTGTGAATCntrC upstream (E. coli)
    MO 8CCTGCCTATCAGGAAATAAAGGntrC downstream (E. coli)
    pCA24N.forGATAACAATTTCACACAGAATTCATTAAAGAGpCA24N upstream of cloned gene
    pCA24N.revCCCATTAACATCACCATCTAATTCAACpCA24N downstream of cloned gene
  • a Underlining indicates strain designations used in this study. GFP, green fluorescent protein.