TABLE 4

Genes and primer sets used in the real-time RT-PCR

TargetGeneFunction, related stressPrimerSequence (5′ to 3′)Primer efficiency (%)Amplicon size (bp)Reference(s) or source
All16S rRNAReference gene16S_FCGATCCCTAGCTGGTCTGAGYersinia, 94; E. coli, 94; Salmonella, 939372
16S_RGTGCAATATTCCCCACTGCT
Y. enterocoliticagsrASerine endoprotease, environmental stressesF_gsrAGACGGTTCTCCGTTCCAAGG918531, this study
R_gsrACACGGAAATCCTGCTTGCTG
ompRTranscriptional regulator, environmental stressesF_ompRTGCTCGACCTGATGTTACCG9310232, 33, this study
R_ompRCACCCTTTGCCGTCACCATA
ailAdhesion and invasion, serum stressF_ailAGCCTTTATGGATTACTGGGGG949635, this study
R_ailCCCGTATGCCATTGACGTCTT
rpoSPolymerase sigma factor, external stressesF_rpoSCAGAACGCGGTTTCCGTTTC959534, this study
R_rpoSCAGACGGATGGTACGGGTTT
E. coli O157:H7ycfROuter membrane protein, chlorine stressEC_F_ycfRGTCATTTGCCAGCTTTGCGG939338, 39, this study
EC_R_ycfRAGATTTGTCCCCGCGTTAGC
ybiJPutative periplasmic protein, iron metabolismEC_F_ybiJTTGCTGCTATGGCTCTTTCA9610038, 40, this study
EC_R_ybiJGAAACCACGCCGATTTTATT
cysDCysteine biosynthesis, oxidative stressEC_F_cysDGCCAGATATCCTGCTCGGTC938538, 41, this study
EC_R_cysDTGGCACAACTATAACGGGCA
cysJSulfite reductase, oxidative stressEC_F_cysJGTGTTTCACTGCGGGTAAGC919038, 42, this study
EC_R_cysJTGAACGAAGCGCTACAGTGG
osmBOsmotic stress-inducible protein, multiple stressesEC_F_osmBTACCCAACGTACTGCCATCG928538, 43, 44, this study
EC_R_osmBTCTAAACGGGACCGCAACAC
S. EnteritidisycfROuter membrane protein, chlorine stressF_ycfRACGCCAGAAGGTCAACAGAA9413445, 70
R_ycfRGGGCCGGTAACAGAGGTAA
cysKCysteine synthase A, oxidative stressF_cysKCGCTATTCAGAAAGCCGAAG9912145, 46
R_cysKCATCGGTGTCTTCCCAGATT
yfhPTranscriptional regulator IScR, oxidative stressF_yfhPTTACCTTAGGCGAGCTGGTG9110445, 47
R_yfhPGCGCGTAATTTAACGTCGAT
nifSCysteine desulfurase, oxidative stressF_nifSATCGCGAAAGAAGAGATGGA9512345, 48
R_nifSTCGCCGTTCAGGTAAACTTC
nifUFe-S cluster assembly protein, oxidative stressF_nifUAACGACGATAACGTGGGAAG9213645, 49
R_nifUGCAGCCGTAAGTCTTGAAGC