TABLE 3

Primers and probes for MST PCR and qPCR assays

AssaySourceTaxon(a)Target (bp)Primer/probe 5′→3′
PCR
    Bac32MammalBacteroides, Prevotella16S rRNA (696)Bac32: AACGCTAGCTACAGGCTT
Bac708: CAATCGGAGTTCTTCGTG
    HF183HumanHuman cluster, Bacteroides, Prevotella16S rRNA (541)HF183: ATCATGAGTTCACATGTCCG
Bac708: CAATCGGAGTTCTTCGTG
    CF128RuminantRuminant cluster, Bacteroides, Prevotella16S rRNA (595)CF128: CCAACYTTCCCGWTACTC
Bac708R: CAATCGGAGTTCTTCGTG
    DF475DogDog cluster, Bacteroides, Prevotella16S rRNA (251)DF475: CGCTTGTATGTACCGGTACG
Bac708: CAATCGGAGTTCTTCGTG
    Gull2GullsCatellicoccus marimammalium16S rRNA (412)Gull2F: TGCATCGACCTAAAGTTTTGAG
Gull2R: GTCAAAGAGCGAGCAGTTACTA
qPCR
    AllBac TaqManMammalBacteroides, Prevotella16S rRNA (108)AllBac296f: GAGAGGAAGGTCCCCCAC
AllBac412r: CGCTACTTGGCTGGTTCAG
AllBac375Bhqr: (FAM)-TGAAGGATGAAGGTTCTATGGATTGTAAACTT (BHQ-1)
    HF183 TaqManHumanHuman cluster Bacteroides, Prevotella16S rRNA (167)HF183: ATCATGAGTTCACATGTCCG
BDFRev: CGTAGGAGTTTGGACCGTGT
BFDFAM: (FAM)-CTGAGAGGAAGGTCCCCCACATTGGA (BHQ-1)
    GFD SYBRAvianUnclassified Helicobacter spp.16S rRNA (123)F: CTGAGAGGAAGGTCCCCCACATTGGATCGGCTGAGCACTCTAGGG
R: CTGAGAGGAAGGTCCCCCACATTGGAGCGTCTCTTTGTACATCCCA