TABLE 2

List of primers used to generate and verify the deletions and complementation of the mutants

PrimerSequence (5′–3′)a
flhCTGTGGATGCGGTGATTAAAG
motBGCGCATATACGGCTCAACTT
sekA_A1494CAGGCAAGACTCAGGGAGTT
sekA_A1497TGGACGCCACGGTAGACTTA
flgLTGCTGGGTAACACTTTTCTCG
flgJACTGGCCAGCGAACAAAG
sekA_A2274TACCGTATGCGTTATTCAGCA
sekA_A2276AAGGGTTCGCTCGACAATTA
c1TTATACGCAAGGCGACAAGG
c2GATCTTCCGTCACAGGTAGG
motAH1P1F2TGTCATAGTCAACAGCGGAAGGATGATGTCGTGCTTATCTTATTAGGTTAGTGTAGGCTGGAGCTGCTTC
motAH2P2 R2TTACGACGACAATGGGATGAGCCTGATTTTTCATGCTTCCTCAGTCGTCTCATATGAATATCCTCCTTA
fliCH2p2ATTGTGTACCACGTGTCGGTGAATCAATCGCCGGACATATGAATATCCTCCTTA
fliCH1p1AATAACATCAAGTTGTAATTGATAAGGAAAAGATCGTGTAGGCTGGAGCTGCTTC
flgKH2p2CATCTGGGTACTGATACGCATGTCATCCTTCTCCTCATATGAATATCCTCCTTA
flgKH1p1TAACAACGAGTATTGAAGGATTAAAAGGAACCATCGTGTAGGCTGGAGCTGCTTC
fljBH1p1TTGCTTTATCAAAAACCTTCCAAAAGGAAAATTTTGTGTAGGCTGGAGCTGCTTC
fljBH2p2CCCCGGATTCACGGGGCTGAATAAAACAAAATAAACATATGAATATCCTCCTTA
flgKFcAAGAGCTCGCGAATCTCGACAATCT
flgKRcAACCCGGGATACGCATGTCATCCTT
fliCFcAAGAGCTCCCTTGATTGTGTACCAC
fliCRcAACCCGGGGAAATTCAGGTGCCGA
motAFcAAGAGCTCCTCACGCTATCACCTCG
motBRcAACCCGGGGAAACGGTGTGGACAA
  • a Italic letters represent SacI restriction site added to 5′ end of primer sequence. Bold letters represent SmaI restriction site added to the 5′ end of the primer sequence. AA nucleotides were added to the end of each restriction site to increase the enzyme efficiency. Underlined letters stand for homology extensions added to the 3′ end of the primer sequence.