TABLE 5

Primers used in this study

SpeciesTarget geneaPrimerSequence (5′ to 3′)Size (bp)Reference
Vibrio spp.16S rRNA567FGGCGTAAAGCGCATGCAGGT12044
680RGAAATTCTACCCCCCTCTACAG
V. alginolyticusdnaJVM-FbCAGGTTTGYTGCACGGCGAAGA14445
V.al2-MmRGATCGAAGTRCCRACACTMGGA
V. choleraectxACTX-FGCAGTCAGGTGGTCTTATGC30846
CTX-RCGTGCCTAACAAATCCCGTC
dnaJVM-FCAGGTTTGYTGCACGGCGAAGA37545
VC-RmmAGCAGCTTATGACCAATACGCC
rfbO1-FGTTTCACTGAACAGATGGG19246
O1-RGGTCATCTGTAAGTACAAC
rfbO139-FAGCCTCTTTATTACGGGTGG44946
O139-RGTCAAACCCGATCGTAAAGG
tcptcpA_72FCACGATAAGAAAACCGGTCAAGAG22
tcpA_477RCGAAAGCACCTTCTTTCACGTTG451 (El Tor), 620 (classical)
tcpA_647RTTACCAAATGCAACGCCGAATG
V. parahaemolyticusdnaJVM-FCAGGTTTGYTGCACGGCGAAGA9645
VP-MmRTGCGAAGAAAGGCTCATCAGAG
tdhtdh-FTCCATCTGTCCCTTTTCCTGC278This study
tdh-RCGAACACAGCAGAATGACCG
trhtrh_FTACCTTTTCCTTCTCCAGGTTCGG12247
trh_RTCGTTTTATGTTTCGGTTTGTCCAGT
V. vulnificusdnaJVM-FCAGGTTTGYTGCACGGCGAAGA41245
VV-RmmGTACGAAATTCTGACCGATCAA
vvpvvp_FGACGTTCAAGCTGACGATGC598This study
vvp_RCACGCCCACTTGGTTAAACG
  • a Genes: dnaJ, housekeeping gene that encodes heat shock protein 40, for identification of Vibrio species; ctxA, cholera toxin; rfb, serotype O1/O139-specific rfb region; tcp, El Tor/classical toxin-coregulated pilus (TCP); tdh, thermostable direct hemolysin (TDH); trh, TDH-related hemolysin; vvp, elastolytic protease.

  • b Universal forward primer for five Vibrio species.