TABLE 2

Features of the VNTR loci composing the newly developed MLVA-7 scheme

Locus nameaGenome of origincStart positionLocalizationTandem repeat sequenceMotif size (bp)VNTR locus size (bp) in the genome of originPrimer sequences (5′-3′) for amplification of repeat regiond
CMmp0131CMR15131842Intergenic regionTGCGGA669FAM-CCCCGGTGGCTTTGTCATTCCCG and GATCGGGCAGCCGGATACCGC
CMmp0233CMR15233468Putative secreted protein Popf1GCCGGA676NED-GCCTGCAGTGCCCACTTCAGGTC and ACCTGCCGTCCGACCTGTTCTTCA
GMch0133GMI1000133827Conserved hypothetical protein, putative 2-nitropropane dioxygenaseTCGCAA641PET-CATCGACCTGAAGCTGGCGCAGG and TGGACTACAGCGTGATGGTCGGCA
GMch0754GMI1000754254Protein of unknown function or conserved protein of unknown function, proline-alanine-aspartic acid repeated motifGGATCGGCA9142VIC-GGCTCGTTGGCGGCTTCGATGTT and CGCTGTTCAACGACCTGCCCGAG
GMch3461GMI10003461892Putative pseudogene (dehydrogenase) proteinAATGGTTG857FAM-CGAGGTCGCTCTCCAGAAGGCGA and CGAGAAGGCCAGTCCCGAGCTGA
GMmp0266GMI1000266226Conserved protein of unknown functionGAAGCGACC9108NED-CCTGTATCGGCGCCGGAGATTGC and TGTCCTTGCCGAACACATCCGCG
CMmp0985 (RS3L20)bCMR15985Putative cobalamin biosynthesis protein (CobN)CGTGAT6128VIC-GCCGCGCCCAGCTCGCACA and AAGGCGCACCGCCACCCGCA
  • a Loci were named according to their genome of origin (CM = CMR15; GM = GMI1000), replicon (mp = megaplasmid; ch = chromosome), and physical position on the replicon.

  • b The CMmp0985 locus (RS3L20) was described previously (20) and was used in this study because it was the only polymorphic locus in the Vallon 2012 collection when the first MLVA scheme (MLVA-13) was used.

  • c Genomic sequences of the reference strains CMR15 (phylotype III) (43) and GMI1000 (phylotype I) (46) were used.

  • d Forward primers were labeled with the following dyes giving the indicated colors: FAM, blue; NED, yellow/black; PET, red; and VIC, green. The annealing temperature was 63°C for all primers.