TABLE 3

Primers used in this study

PrimerSequenceaPurpose
ureC_p_SGACATCAAAGGTCTGTGGATCGGeneration of probes used in Southern analysis
ureC_p_ASCTGGTCCTGCTGATGGAAGTAA
phage_24328_SGAGCCGCCACAAGGTGTTCTTT
phage_25698_ASCGCACTCACAATAACCACCTCC
phage_1_STGGCATGTTGCCATACTCAAACAGTConformation of YMC-2011 as circular molecule by PCR
phage_5000_ASCTGTAGTTCCTTCTTCTACGACGTT
phage_4776_SACACAAAGAATGCGCAGTGTGGCAT
phage_9776_ASATGTCATTTATTGGGGATATCACCG
phage_9531_SCACAGATAGAGACATTGAACTGCTC
phage_14550_ASTGTTCCCAATCGATTGAATCCAAGG
phage_14326_STTGACGGCTCGGACTTTGAACGCAC
phage_19390_ASTGTAATCGTCTTTGATTGCCCAATT
phage_19140_SGTACAAGCTGGTATCTACGTGGATG
phage_24170_ASGTAGCTCGGTGTTCTGTTTCGTTCT
phage_23871_SACCGAGATGATGAGAGTAAGGAACG
phage_29000_ASTACCATTGGCATTTAGGGCGTTCTT
phage_28800_SCGTCACTTTTGATGATCCACGCATT
phage_33865_ASAGAGATTTCTTGTGTGCGGACATTG
phage_33651_SCAAGCAACCGTAATGTGTTGCGTAT
phage_38666_ASAACCGTTACGGATATTGTTGTGCCC
phage_38431_SCGATGGCGTGATTCGGTTGTTCGAG
phage_2600_ASAGCGCTCTGACATATCGCTCAGATT
phage_3019_S_002GGTTACGTCGATGGTTTTGGGCqPCR for YMC-2011 copy number estimation
phage_3245_AS_002CCTCTTGGGATAGTTGTCAGTG
phage_18928_S_031TGGCAAGTCATTTCTGCCAGCC
phage_19142_AS_031ACATCGTCACCAATAATGACGG
phage_36884_S_063GGGATAACGTCAAGAAATTCGC
phage_37122_AS_063GGTCAATGCGTCGGTGATTAGC
codY_1170_SGGCTGCTCAATTGGCGGATATCAT
codY_1280_ASCTCCTCCACACGATCATTGTTGGTT
lacZ_1241_SGGGATATCAAAGTGATGAAAC
lacZ_1465_ASGGCACGATCCAAACAAGC
ureC_6301_SGGACCAACTGTAGGTGATAGCGTAC
ureC_6460_ASTGGATTGTCACGTGTTTCCGTAGC
lacZ_1241_SGGGATATCAAAGTGATGAAACNegative control for Fig. 4
lacZ_1465_ASGGCACGATCCAAACAAGC
phage_9787_013_SATTCTCAGCTTTTGCGTTCATGRT-PCR for transcription organization study
phage_10755_017_ASACTGATTACTGGCTCATGATTT
phage_10134_014_SCAGACTTGCTCGGAGTTGATT
phage_20582_016_ASCAACGAATCTGTTAGCGAAGC
phage_24765_042_SAGCCATGCAACTAGGTCTCA
phage_25034_043_ASATGGCAAAAAAACGTATGACGT
phage_25162_045_ASTGTGTCTTCCGTCTGCTCAT
phage_10757_R1_ASGCACTGATTACTGGCTCATG5′ RACE for Ssal_phage00013
phage_10653_R2_ASGGAGAGACAAGCCATGATTGAA
phage_10514_R3_ASTTGCTATTTCAAGTGCTATCGC
phage_9251_L1_SCTCATCACAAATCGTGGTGAG5′ RACE for Ssal_phage00014
phage_9369_L2_STTTCACGCAACCGTTCATAGTC
phage_9479_L3_SCTGTTTACAGGGTCGATAAAGC
lacZ_SGGTTTTGGTTCTCCACAATATGTGConstruction of pL-cat and pR-cat fusions
pureI_481SmaI_ASAATCCCGGGGACCATATGGGAGTCGGTAC
pureI_958SalI_SGAGGTCGACATGAACTTTAATAAAATTGATTT
lacZ_ASCAGCAACATATTGACCGCGAAC
phage_9943SmaI_PR_SGTACCCGGGATTTCTCTTTCTTTCTATATAT
phage_10067SalI_PR_ASATTGTCGACCTCCTTCCTTAAGCTTGATTTAAGTA
phage_10067SmaI_PL_SGCTCCCGGGTTCCTTAAGCTTGATTTAAGTA
phage_9943SalI_PL_ASTTTGTCGACCTCCATTTCTCTTTCTTTCTATATAT
codY+_815BamHI_STTGGATCCCTGGACAAAAAGGCTTGTCCPCR for establishing intact codY in strain ΔcodY
codY+_3606SphI_ASATAGCATGCCTTGTGACATTCTTTGAAGAGG
codY+_518SacI_S_1GGTGAGCTCGTTTCAGAGATGATTTCCATGT
codY+_824BamHI_ASAGGGATCCAAGAAATTAACGCTTGTAATATG
  • a Inserted restriction recognition sites are underlined.