TABLE 1

Primers used in this study

Primer no.Primer nameSequence (5′→3′)
1pConst F SacIAAAAGAGCTCAATTTTGCAAAAAGTT
2pConst R PstITTTCTGCAGCACTCTCCTTCTACATTTTTTAAC
3pheS* SOE B.S. FATATCAGGGCTTCGGATTCG GAATGGGTGT TGA
4pheS* SOE B.S. RCCATTCCGAATCCGAAGCCC TGATATTCCT TCG
5KpnI Phes BS RTTTTGGTACCTTACGCCTGTTTAAACTGC
6PstI Phes BS FAAAACTGCAGATGGAAGAAAAGCTAAAACAGC
7ZBM pGEX3CCGGGAGCTGCATGTGTCAGAGG
8pPL2 revACTATAGGGCGAATTGGAG
9pPL2 Gibson FCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTCCGGGAGCTGCATGT
10pPL2 Gibson RCCGCTAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCGAGCTCAATTTTGCAAAAAGTTG
11pLR4 Gibson FGCGTAACGGCAAAAGCACCGC
12pLR4 Gibson RACCACCCCGTCAGTAGCT
13Throw FACCTTACGCCTGTTTAAACT
14Throw RCGTTTCGGTGATGACGG
15Δmonocin_A_SalIAAAAGTCGACTTAAGGCTTGGGCAAATTTTG
16Δmonocin_BTGCGGAAGAGAAGTTAATTTGGTTGGATATCTCTCCAG
17Δmonocin_CAGAGATATCCAACCAAATTAACTTCTCTTCCGCAAAAC
18Δmonocin_D_PspOMITTTTGGGCCCTGTTCAACCATTTGGTAACATTC
19ΔftbQ-R_A_PspOMIAAAGGGCCCGGCTTTATGAGTTCTTTTGATAAACAA
20ΔftbQ-R_BCGCTCCTTTTTGGAAAACCTCCTTTTTAGTTAC
21ΔftbQ-R_CGGAGGTTTTCCAAAAAGGAGCGGCC
22ΔftbQ-R_D_SalIAAAGTCGACCTATTTGGCGGCGGC
23T3ATTAACCCTCACTAAAGGGA
24pLR16 revCCAATAACTTAAGGGTAACTAGCC