TABLE 3

Primers used for diagnostic PCR

Primer-binding regionPrimer nameSequence (5′ to 3′)
Upstream of phaP1phaP1-upCCTACGTCAACGTGGATTACTT
Downstream of phaP1phaP1-downGGCAGTGACAGAAAATACCAAT
Upstream of phaP2phaP2-upGGCAGTGACAGAAAATACCAAT
Downstream of phaP2phaP2-downAGTCCGCCTTTTTCTATACGAC
Upstream of phaP3phaP3-upAGCGGGTTTGTTATTGTCTTC
Downstream of phaP3phaP3-downACCATTAAGGTCATCATACGGTAG
Upstream of phaP4phaP4-upGTAAAGAGCGACCAGAACGTAT
Downstream of phaP4phaP4-downAGTGATGAAGCGCTATGAAGAG
Upstream of phaRphaR-upTTGACGATTGAATCCAAAGAAT
Downstream of phaRphaR-downACGCATCATCAATATTTCGTC
Upstream of phaCphaC-upGCTCATGTTTTCCTGACCGC
Downstream of phaCphaC-downAACCCCCTGCGAATGCAATA