TABLE 1

Primer, probe, and inhibition control synthetic gene sequences

Primer, probe, or control gene nameSequence (5′–3′)a
E. vermicularis 5S_fwdCAAACAACTGCATCACCAATAAC
E. vermicularis 5S_revAGTGTAGAGCAATAAGCAGTAAAG
E. vermicularis 5S probeFAM-TACCAACAACACTTGCACGTCTCTTCA-IBFQ
E. caproni 28S_fwdTAGGCAATGTGGTGTTCAGG
E. caproni 28S_revCATAGAGGGTGAAAGGCCC
E. caproni 28S probeFAM-AGGACTTAGGGTGGAGCAGTATCCC-IBFQ
Inhib Con_fwdGGTTACGTTACCGATTGTGTTAT
Inhib Con_revGCACGGAGAAGTATTCTTGATATAG
Inhibition control probeJOE-TCGCATACTATGACCGAGACCCTGT-IBFQ
Inhibition control sequenceCCAATGCAATGGCTAACACAATATTATATTTTAAAGAATGAATATCATAAGACCATGCTAGCGTATGATAATGGATCTTGGACATAAGATATAGTTCTTATGAAGAGGCAAAAAAACACGATGATGGACTTATCATTATTTCTATATTCTTACAAGTATTGGATCATAA
  • a FAM, 6-carboxyfluorescein; IBFQ, Iowa black fluorescent quencher; JOE, 6′-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein, succinimidyl ester.