TABLE 2

Primers used for cloning PCR

PCR target regionPrimer nameProduct size (bp)Sequence (5′ to 3′)Restriction site
5′ region of phaP1phaP1-LF1,133ACACCAGGATCCCGCTAGGCTCTGCGAAATCTBamHI
phaP1-LRCACCTATCTAGAAACTTCAAGCAAGCCACCGAXbaI
3′ region of phaP1phaP1-RF1,121ACACCATCTAGAGGGTTGCTTACACCCTCGTTXbaI
phaP1-RRCACCTAAAGCTTAATGTCCCGGTAGAGATGCGHindIII
5′ region of phaP2phaP2-LF1,074ACACCAGGATCCTGTTTAGCTGGCTGCTGTTCBamHI
phaP2-LRCACCTATCTAGATCTCGAAGCTCGACACAGTTXbaI
3′ region of phaP2phaP2-RF1,001ACACCATCTAGAAACTCGGCGTACGAAGCTGXbaI
phaP2-RRCACCTAAAGCTTGAAGCGTATCGACGGGGAAGHindIII
5′ region of phaP3phaP3-LF1,015ACACCAGGATCCCTGTGCCTGAGGCGAGTACGBamHI
phaP3-LRCACCTATCTAGAGAAGCCTATGCGCTCGTCAXbaI
3′ region of phaP3phaP3-RF1,040ACACCATCTAGACGAACCCGGGAAGCTGATACXbaI
phaP3-RRCACCTAAAGCTTAGCGTCCCGTCCATTGAATCHindIII
5′ region of phaP4phaP4-LF1,018ACACCAGGATCCGAGCCGACTCATTTCCACGABamHI
phaP4-LRCACCTATCTAGACGGAATGAAGCAAGCGTTCGXbaI
3′ region of phaP4phaP4-RF1,025ACACCATCTAGACGGTCTTGATGGTCTGCACGXbaI
phaP4-RRCACCTAAAGCTTGGAAGAGTCGCCTGTCGAGHindIII
5′ region of phaRphaR-LF1,027ACACCAGGATCCCGACGAGATCGGTCATGCGBamHI
phaR-LRCACCTATCTAGAGCAGGCGAAGTCGATGTTCAXbaI
3′ region of phaRphaR-RF1,036ACACCATCTAGACGTGATGTACGTGCTCGTCTXbaI
phaR-RRCACCTAAAGCTTGAGATCGCCGTCCGCATAAHindIII
Complementation of phaRphaR-comF1,232ACACCAGAATTCGCGAAACCATGCCGATTTTCEcoRI
phaR-comRCACCTAGAATTCGGACATGGTGAAGTCCATCCEcoRI