TABLE 2

Oligonucleotides used in this work

OligonucleotideSequence (5′ to 3′)
Construction of pCOR31, pCOR33, and pCOR35
    mCla_SnaBI_CMV_NeoFCCAAATCGATCTACGTATTAGTCATCGCTATT
    Cla_EcoRV_NeoRCCAAATCGATGATATCCGGATATAGTTCC
Construction of pMTX708/pMTX709
    NotI_PtacCCAGCGGCCGCTTATCGACTGCACGG
    NotI_oriT1CCAGCGGCCGCTCATTTTCTGCATCATTGT
Detection of oriT-specific integration events
    Int_pCORTCAGGGCGTCCGTTTC
    Int_pCOR_2CTGCATCACATTTGCATC
    NotI_PtacCCAGCGGCCGCTTATCGACTGCACGG
    NotI_Ptac_2CACTGCATAATTCGTGTC
    NotI_oriT1CCAGCGGCCGCTCATTTTCTGCATCATTGT
PCR mapping of inserts in recovered integrated plasmids
    pCOR33_121FTGGACAACCCTGCTGGAC
    pCOR33_644RTTTCGCCCTATATCTAGTTC
    pCOR33_1641FCTCGACCTGAATGGAAGCC
    pCOR33_2158RAGCTGGCGTAATAGCGAAG
    pCOR33_3157FCGCAACCCCTTGTAAATGC
    pCOR33_3664RTCTGAACGGCGGTAATCC
    pCOR33_10431FCCTGGCTGACCGCCCAA
    pCOR33_10940RGCTTCTAGAGATCTGACGG
    pCOR33_11927FTCAGGTTCAGGGGGAGGT
    pCOR33_12445RAATACGCAAACCGCCTCTC
Detection of oriT in HeLa::oriT
    oriT1CTCATTTTCTGCATCATCA
    oriT330CCTCTCCCGTAGTGTTA
Analysis of G418-resistant cell pools
    670_TrwCTGTGTGCTAGGTCGAA
    BamHI_TrwA_RAACAGGATCCTCAATCCTCCTTCCCCTCCC
    Hind3_TrwA_FAACAAAGCTTATGGCACTAGGCGACCCC
    Hind3_TrwC_FAACAAAGCTTATGCTCAGTCACATGGTATT
LAM-PCR and high-throughput sequencing
    LC1GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGG(N)12CTA(RO)a
    LC2(RO)TAG(N)12CCTAACTGCTGTGCCACTGAATTCAGATCa
    LCIGACCCGGGAGATCTGAATTC
    Mis-LC(PE-PCR 2.0)AGTGGCACAGCAGTTAGGb
    Mis-TrwC(PE-PCR 1.0)(N)10CGTCCTTAAAAGCCGGGTTGc
    oriTICGATAACCCAATGCGCATAG
    oriTIITCTTTAGGGTCACGCTGGC
    PE-PCR 1.0AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    PE-PCR 2.0CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
Sequencing of human genomic DNA
    Chr15_88728ATATGAATGTTTGCATTCCTT
    IS2_Hu11AAGAAAGTCAACCTTCATCTT
    Xba_IS2_Hu11CAACTCTAGAGGAAAAGTCAGAAAGACACCAAC
  • a (N)12, barcode sequence of linker cassette. (RO), restriction enzyme overhang.

  • b (PE-PCR 2.0), adaptor sequences for high-throughput sequencing.

  • c (PE-PCR 1.0), adaptor sequences for high-throughput sequencing; (N)10, barcode sequence introduced in second exponential PCR.