TABLE 3

Primer sequences used in this study

PrimerFunctionReaction or coordinatesb (plate/well)Sequence (5′–3′)
olj376Preparing Tn-seq libraries (essential genome)PCR-1GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG
olj510_mariner (mariner-1)PCR-1ACTCACTATAGGAGGGCGGGAATCATTTGAAGGTTGGTAC
BC_aPCR-2CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTG
olj511_mariner (mariner-2)PCR-2Biotin-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNGTGTCAGACCGGGGACTTATCAG
VT1169_0386-FValidating ordered library29/H10GACGCTTCCTGATGAACAAAAGTGC
VT1169_0386-R29/H10CCACCATCATCTTCTTGCTCGTAGG
VT1169_1989-F14/H12GTAAAGTCTGCGTTAGAATAGCGAGAAATCC
VT1169_1989-R14/H12GTCACCCCATACAACGGCAC
VT1169_0152-F37/B10GGTCCATAACCCTCAATCTCATCAGC
VT1169_0562-R34/G5CGGACATAAACTGCCAAATCCAGC
VT1169_1175-R34/E2ACGCAAATTCGTTAGCAACTACTGC
VT1169_1449-R37/B4GTTTTGTGCGAATGGCGTTTGC
VT1169_1462-R18/F3GACGCTAACGGTGAGCTTTCC
VT1169_1954-F37/H12GACCCCGCCTTCAATATCATTTGG
mariner-2-checkGTGTCAGACCGGGGACTTATCAG
  • a The primer is named after the Illumina barcode that is used (e.g., the x's in the sequence for BC01 are replaced with Illumina barcode 1).

  • b Coordinates in the ordered library from which individual colonies were isolated.